View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15734_high_16 (Length: 234)
Name: NF15734_high_16
Description: NF15734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15734_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 8091759 - 8091980
Alignment:
| Q |
1 |
cacttgatcaccgacaaaatgacacgctcattttattttgtaagaggaactgccctcctttctcttctatgattatactcataagtt---tatttgactt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
8091759 |
cacttgatcaccgacaaaatgacacgctcattttattttgtaagaggaactgccctcctttctcttctaagattatactcataagttgcttatttgactt |
8091858 |
T |
 |
| Q |
98 |
ttcttatctatatatgttgcagagcacaccaaggttttggatgggttggcgaatgggcaaacgcaaggtaggttggttagtttagtgcatctttaaattg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8091859 |
ttcttatctatatatgttgcagagcacaccaaggttttggatgggttggcgaatgggcaaacgcaaggtaggttggttagtttagtgcatctttaaattg |
8091958 |
T |
 |
| Q |
198 |
atggtgcgtttggcaaaattac |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8091959 |
atggtgcgtttggcaaaattac |
8091980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University