View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15734_low_14 (Length: 270)
Name: NF15734_low_14
Description: NF15734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15734_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 17 - 257
Target Start/End: Original strand, 39944223 - 39944463
Alignment:
| Q |
17 |
aggaaggagaactatgagaaacacactaaatttaagagatgctttgggattagtaggcaatggatccaatcaagttattgatggttatctttagtagtaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944223 |
aggaaggagaactatgagaaacacactaaatttaagagatgctttgggattagtaggcaatggatccaatcaagttattgatggttatctttagtagtaa |
39944322 |
T |
 |
| Q |
117 |
tcacttggagacaaaatattcgagaaaagataatttaatttgataaattttaatattatctttagcttgaccaaattttgcatatctattattagattca |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944323 |
tcacttggagacaaaatatttgagaaaagataatttaatttgataaattttaatattatctttagcttgaccaaattttgcatatctattattagattca |
39944422 |
T |
 |
| Q |
217 |
tcattccagaaacagatatattcttcacattcatcatgatg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39944423 |
tcattccagaaacagatatattcttcacattgatcatgatg |
39944463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 96
Target Start/End: Original strand, 44761008 - 44761086
Alignment:
| Q |
18 |
ggaaggagaactatgagaaacacactaaatttaagagatgctttgggattagtaggcaatggatccaatcaagttattg |
96 |
Q |
| |
|
||||||||||| |||| || |||||| ||||| ||||||||| | ||| | |||||||||| |||||| ||||||||| |
|
|
| T |
44761008 |
ggaaggagaaccatgacaagcacacttaatttcagagatgctcttggaatcataggcaatgggtccaattaagttattg |
44761086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University