View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15734_low_22 (Length: 206)

Name: NF15734_low_22
Description: NF15734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15734_low_22
NF15734_low_22
[»] chr1 (1 HSPs)
chr1 (84-193)||(6451364-6451473)


Alignment Details
Target: chr1 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 84 - 193
Target Start/End: Original strand, 6451364 - 6451473
Alignment:
84 attaaataacatctctgcgtctgcatcatgtggctctgtgacatggttggtgtcaccgaacatcacaggctacacttatggtcatatattccttcccctt 183  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6451364 attaaataacatctctgcgtctgcatcatgtggctctgtgacctggttggtgtcaccgaacatcacaggctacacttatggtcatatattccttcccctt 6451463  T
184 aattttcttc 193  Q
    ||||||||||    
6451464 aattttcttc 6451473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University