View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_high_37 (Length: 354)
Name: NF15735_high_37
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 18 - 343
Target Start/End: Original strand, 55887619 - 55887944
Alignment:
| Q |
18 |
gtaacagttatttgctgctaaccaaaagaaaccggctgaaatcattggtatacttgttgcgaacagaagcaagcttcttaggctgttaggcgacttgaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55887619 |
gtaacagttatttgctgctaaccaaaagaaaccggctgaaatcattggtatacttgttgcgaacagaagcaagcttcttaggctgttaggcgacttgaaa |
55887718 |
T |
|
| Q |
118 |
attgataaaggtaagggattagacgttatttgtcaagagttttgcatttcttttgatggtaccatgttcctaaatttacatatttattgggatgttcaga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55887719 |
attgataaaggtaagggattagacgttatctgtcaagagttttgcatttcttttgatggtaccatgttcctaaatttacatatttattgggatgttcaga |
55887818 |
T |
|
| Q |
218 |
ggatgaacaatttgaagctgacaaagctcaagttatgaaggaaattgctgctcttgaacctaaggagtagggaccatcatgagctccgtgttgtgtcaag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55887819 |
ggatgaacaatttgaagctgacaaagctcaggttatgaaggaaattgctgctcttgaacctaaggagtagggaccatcatgagctccgtgttgtgtcaag |
55887918 |
T |
|
| Q |
318 |
tagcaagttgaattgtgccttttcat |
343 |
Q |
| |
|
|||||||||||| |||||| |||||| |
|
|
| T |
55887919 |
tagcaagttgaactgtgccctttcat |
55887944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 216 - 335
Target Start/End: Original strand, 9623874 - 9623994
Alignment:
| Q |
216 |
gaggatgaacaatttgaagctgacaaagctcaagttatgaaggaaattgctgctcttgaacctaaggagtagggaccat-catgagctccgtgttgtgtc |
314 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||| ||| |||||| |
|
|
| T |
9623874 |
gaggatgaccaatttgaacctgacaaagctcaagttatgaaggaaatttctgctcttgaacctaaggagtagggaccatccttgagcttcgtattgtgtt |
9623973 |
T |
|
| Q |
315 |
aagtagcaagttgaattgtgc |
335 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
9623974 |
aagtagcaagttgcattgtgc |
9623994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 26 - 125
Target Start/End: Original strand, 9623774 - 9623872
Alignment:
| Q |
26 |
tatttgctgctaaccaaaagaaaccggctgaaatcattggtatacttgttgcgaacagaagcaagcttcttaggctgttaggcgacttgaaaattgataa |
125 |
Q |
| |
|
|||||| ||||||| |||||||||| || |||||||| ||||||||||||| |||| ||||||| |||| || |||||||||||||||||||| ||||| |
|
|
| T |
9623774 |
tatttgttgctaactaaaagaaaccacct-aaatcattagtatacttgttgcaaacaaaagcaagtttctgagactgttaggcgacttgaaaatcgataa |
9623872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 214 - 275
Target Start/End: Original strand, 9400044 - 9400105
Alignment:
| Q |
214 |
cagaggatgaacaatttgaagctgacaaagctcaagttatgaaggaaattgctgctcttgaa |
275 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || ||| ||||||||||| |||||||| |
|
|
| T |
9400044 |
cagaggatgaacagtttgaagctgacaaagctcaggtgatggaggaaattgcttctcttgaa |
9400105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University