View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_high_45 (Length: 319)
Name: NF15735_high_45
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_high_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 308
Target Start/End: Complemental strand, 48142955 - 48142653
Alignment:
| Q |
1 |
ccatccttttgagtgagcctacattcaattcaccaacttattgcaacacatcaattcataaaaagtgattataatggatggtaatcttgtattttattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48142955 |
ccatccttttgagtgagcctacattcaattcaccaacttattgcaacacatcaattcataaaaagtgattataatggatggtaatcttgtattttattga |
48142856 |
T |
|
| Q |
101 |
attaatcatttatcctttattgtgattaattgtgaacaaaagtaaagctcttagtacaacgaaccttgtaacatgggaccaaaccaattcactacaacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48142855 |
attaatcatttatcctttattgtgattaattgtgaacaaaagtaaagctcttagtacaacgaactttgtaacatgggaccaaaccaattcaccacaacca |
48142756 |
T |
|
| Q |
201 |
tttctgatctgcatgcaatataatgaaacacatcatagcatgaagattcagccagcacatcatgaatctgaatattgttatgcatgactgagcaactctg |
300 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48142755 |
tttctgatctgcatgc-----aatgaaacacatcatagcatgaagagtcagccagcacatcatgaatttgaatattgttatgcatgactgagcaactctg |
48142661 |
T |
|
| Q |
301 |
aacattct |
308 |
Q |
| |
|
|||||||| |
|
|
| T |
48142660 |
aacattct |
48142653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University