View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_high_47 (Length: 307)
Name: NF15735_high_47
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_high_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 5e-25; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 62 - 165
Target Start/End: Original strand, 31087534 - 31087641
Alignment:
| Q |
62 |
aaatagtatatcataggactagcaaattgttcaaattacactacactatatgcgctatttaaca----tgtttcattcacaagtcacaaccacagcaata |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||| |||| ||||||||||| | || ||||| |||| |
|
|
| T |
31087534 |
aaatagtatatcataggactagcaaattgttcaaattacactacactttaggggctatttaacaacattgttccattcacaagttaaaaacacaggaata |
31087633 |
T |
 |
| Q |
158 |
taccacat |
165 |
Q |
| |
|
|||||||| |
|
|
| T |
31087634 |
taccacat |
31087641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 12 - 65
Target Start/End: Original strand, 31086941 - 31086994
Alignment:
| Q |
12 |
ggtctctgatccgctgctgtgtttaaatgtgaaaacatcaaatagacccaaaat |
65 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31086941 |
ggtctctgatctgctactgtgtttaaatgtgaaaacatcaaatagaccctaaat |
31086994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 161 - 196
Target Start/End: Original strand, 31087672 - 31087707
Alignment:
| Q |
161 |
cacattgttaatttgttcatatgctaaactttaaag |
196 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31087672 |
cacatagttaatttgttcatatgctaaactttaaag |
31087707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University