View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_high_51 (Length: 295)
Name: NF15735_high_51
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_high_51 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 295
Target Start/End: Original strand, 31318395 - 31318669
Alignment:
| Q |
19 |
ttatgagcaaacaagacacaaaattgcagaatttttaatttccaattggagaatgatagctaagtgtcatttcataaatcatgtgtaatgagaatgcaca |
118 |
Q |
| |
|
|||||||||||||||| | ||| |||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31318395 |
ttatgagcaaacaagagagaaagttgcagaatttttattatccaattggagaatgatagctaagtgtcatttcataaatcatgtgtaatgagaatgcaca |
31318494 |
T |
 |
| Q |
119 |
agcaaatcaaaatactaacaaattcctgtattggtgtatgtgatgagtagtctgagacaatagttaccttcaagatgaaaatatgttatgcatgctccga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31318495 |
agcaaatcaaaatactaacaaattcctgtattggtgtatgtgatgagtagtctgagacaatagttaccttcaagatgaaaatatgttatgcatgctccga |
31318594 |
T |
 |
| Q |
219 |
ttgaatacatagagattccataaatttacgcgctcgcttggccaaagagatgggaggagcaacacagggaggacgga |
295 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31318595 |
ttgaatacacagagattccataaatttacacgctctctttgccaaagagatgggaggagcaacac--ggaggacgga |
31318669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University