View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_high_59 (Length: 260)
Name: NF15735_high_59
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_high_59 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 10 - 260
Target Start/End: Complemental strand, 39305840 - 39305593
Alignment:
| Q |
10 |
gaagcaaagggctgatcccaacactcttccagatttcgtctcgtggattaattccaactcaagcttctagttactggggagtttggttctgattaagatt |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39305840 |
gaagcatagggctgatcccaacactcttccagatttcgtctcgtggattaattccaactcaagcttctagttactggggagtttgtttctgattaagatt |
39305741 |
T |
 |
| Q |
110 |
gcatttcagatatataataattgctacctttgttgttaccatattttctatgtatacctgcgtagaataataatatctacgaacaaacatttagtgtagc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39305740 |
gcatttcagatatataataattgctacctttgttgttaccatattttctatgtatacctgcgtagaat---aatatctacgaacaaacatttagtgtagc |
39305644 |
T |
 |
| Q |
210 |
tcataataaaatgaagtgcacccaaacaatatgaactatattttattttta |
260 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39305643 |
tcataataaaatgaattgcacccaaacaatatgaactatattttattttta |
39305593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University