View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_high_62 (Length: 253)
Name: NF15735_high_62
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_high_62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 50504594 - 50504461
Alignment:
| Q |
1 |
gtgttaacgggcacaagatggcacatggtggtgg---ccattgcatcagctgaattggaccagatgtcagagctggggggttaactatatattgacattg |
97 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50504594 |
gtgttaactggcacaagatggcacatggtggtggtggccattgcatcagctgaattggaccagatgtcagagctggggggttaactatatattgacattg |
50504495 |
T |
|
| Q |
98 |
atgtattagtaacccccacaaccacctaaaccttc |
132 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
50504494 |
atgtattagtaa-ccccacaaccacctaaaccttc |
50504461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 128 - 218
Target Start/End: Complemental strand, 50504414 - 50504324
Alignment:
| Q |
128 |
ccttcatttactttcgtagattattaatttattaggctggcctgatactgaataccataatcaactttaaaactcttgcgaatgtgttagt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50504414 |
ccttcatttactttcgtagattattaatttattaggctggcctgaaactgaataccataatcaactttaaaactcttgcgaatgtgttagt |
50504324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University