View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_high_71 (Length: 236)
Name: NF15735_high_71
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_high_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 32506306 - 32506530
Alignment:
| Q |
1 |
cccatttataaaattgaacatagtccccactttcttgattcacaactatgccttaatgtcaacnnnnnnnnnnn----ctacattccaaaattactctat |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32506306 |
cccatttataaaattgaacatagtccccactttcttgattcacaactatgccttaatgtcaaaaaaaaaaaaaaaaaactacattccaaaattactctat |
32506405 |
T |
|
| Q |
97 |
tcccttattagcattttccattctttatttatgttgaagaacgtgaactttctatttatattgcctaagagtcagaaccataagataataatgtccctag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32506406 |
tcccttattagcattttccattctttatttatgttgaagaacgtgaactttctatttatattgcctaagagtcagaaccataagataataatgtccctag |
32506505 |
T |
|
| Q |
197 |
agtctacacatgtagatgttttttg |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32506506 |
agtctacacatgtagatgttttttg |
32506530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University