View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_high_73 (Length: 234)
Name: NF15735_high_73
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_high_73 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 20 - 193
Target Start/End: Original strand, 10495147 - 10495320
Alignment:
| Q |
20 |
aaaaacctgatagcaatccaaaatatggttatactttaaggcggtggagtgcgtcaaacgctctatttacttatgaggtaggagtgaggtagtttatgaa |
119 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10495147 |
aaaaacttgataacaatccaaaatatggttatactttaaggcggtggagcgcgtcaaacgctctatttacttatgaggtaggagtgaggtagtttatgaa |
10495246 |
T |
 |
| Q |
120 |
atgtagtaaaaggtagttactcttagttgcacgttgttatggaatgctatttctcttgaggtgatgcaagaggt |
193 |
Q |
| |
|
|||||||||||||| ||||| || |||||||| ||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
10495247 |
atgtagtaaaaggttgttaccctgagttgcacattgttctggaatgctatttctcttgaggtggtgcaagaggt |
10495320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University