View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_high_74 (Length: 234)
Name: NF15735_high_74
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_high_74 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 19395992 - 19396195
Alignment:
| Q |
16 |
gagggagttgctcagaagttgccttgattcagcaaatatcatctccatctttttcttcaattctccttccgggaaaccgtcagaacaagtgtcttggtaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19395992 |
gagggagttgctcagaagttgccttgattcagcaaatatcatctccatctttttcttcaattctccttccgggaaaccgtcagaacaagtgtcctggtaa |
19396091 |
T |
 |
| Q |
116 |
gatataacagcactaagccaattgttcaactcagcttcttttgaagctagtttgctaatatcaagttgcccgacttcagtgatcgagaatcccatttctt |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396092 |
gatataacagcactaagccagttgttcaactcagcttcttttgaagctagtttgctaatatcaagttgcccgacttcagtgatcgagaatcccatttctt |
19396191 |
T |
 |
| Q |
216 |
cttt |
219 |
Q |
| |
|
|||| |
|
|
| T |
19396192 |
cttt |
19396195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University