View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_low_39 (Length: 369)
Name: NF15735_low_39
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 161 - 353
Target Start/End: Complemental strand, 44598825 - 44598632
Alignment:
| Q |
161 |
gtacaataaatcttgaatttaacagcctagagtttacgatagtttcataattttatacttaatgattatattagtacatcatcagatttactcagatctt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44598825 |
gtacaataaatcttgaatttaacagcctagagtttatgatagtttcataattttatacttaatgattatattagtacatcatcagatttactcagatctt |
44598726 |
T |
 |
| Q |
261 |
gttaccaaagaaaaaattatttactcatagctacatacaag-ttgaatttaaaaatttaacctagtcaaaatttagattgagttaggaagaaac |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44598725 |
gttaccaaagaaaaaattatttactcatagctacatacaagtttgaatttaaaaatttaacctagtcaaaatttagattgagttaggaagaaac |
44598632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 44598979 - 44598893
Alignment:
| Q |
8 |
attattctaaaaatcttatgaatctacaagtgggatgtacaaatcaatttcacaggcaaagcaaagcaactttgtttaaaagtttct |
94 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
44598979 |
attattttaaaaatcttatgaatctacaagtgggatgtacaaatcaatttcacaagcaaagcaaagcaactttgtttaaaactttct |
44598893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University