View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_low_41 (Length: 359)
Name: NF15735_low_41
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 8e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 15 - 274
Target Start/End: Complemental strand, 35321914 - 35321652
Alignment:
| Q |
15 |
cagcaatcatcacattcaaaattaattaccataggataggataggat-----ctagcaaaatgtgactctatcaattaaatttctattggtgaaaaacca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35321914 |
cagcaatcatcacattcaaaattaattaccataggataggataggataggatctagcaaaatgtgactctatcaattaaatttctattggtgaaaaacca |
35321815 |
T |
|
| Q |
110 |
ttcggaattaatttttgaatctataggtgtgactagcatttagggacgatccgaaagtaaagcctt-nnnnnnnnnnnnnnnnnnnctatttgatggaaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
35321814 |
ttcggaattaatttttgaatctataggtgtgactagcatttagggacgacccaaaagtaaagccttaaaaaaagtaaactaaaaaactatttgatggaaa |
35321715 |
T |
|
| Q |
209 |
agtatcatgtgatgaggtcatgagtccatgattttctctattctattagtgtcacaacttttttcc |
274 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
35321714 |
agtatcatgtggtgaggtcatgagtccatgattttctctattctat---tgtcacaacatttttcc |
35321652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University