View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_low_45 (Length: 343)
Name: NF15735_low_45
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 11 - 329
Target Start/End: Complemental strand, 34294154 - 34293836
Alignment:
| Q |
11 |
cacagataaactatataatataggaactgaaaataagcttttaattttggtttgcactttttagtcctaattatcgtgattctgcgattttgtccttcag |
110 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34294154 |
cacagattaactatataatataggaactgaaaataagcttttaattttggtttgcactttttagtcctagttatcgtgattctgcgattttgtccttcag |
34294055 |
T |
 |
| Q |
111 |
nnnnnnnnnnnnnnngaccccttttgtggtttctcctttgtaattcggtcggtagtctcccataannnnnnnnctcaaatttatgcttaggtgacattat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34294054 |
ttttttagcttttttgaccccttttgtggtttctcctttgtaattcggtcggtagtctcccataattttttttctcaaatttatgcttaggtgacattat |
34293955 |
T |
 |
| Q |
211 |
ttattgacttgacactgaagttcaatattcagcatggttttctnnnnnnnnnnnnntttgtaacaagtcgtctagctatgaaacttttgaccacaatcat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34293954 |
ttattgacttgacactgaagttcaatattcagcatggttttctaaaaattaaaaaatttgtaacaagtcgtctagctaagaaacttttgaccacaatcac |
34293855 |
T |
 |
| Q |
311 |
gatatttagagtcaaaagt |
329 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34293854 |
gatatttagagtcaaaagt |
34293836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University