View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_low_58 (Length: 292)
Name: NF15735_low_58
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 26459043 - 26459308
Alignment:
| Q |
18 |
taaatgatactatttgatagcagcactggcttaatcagtttcataagaattaaccttgcttgcaagttaatgttaagggcattcttgttgattgattatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26459043 |
taaatgatactatttgatagcagcactggcttaatcagtttcataagaattcaccttgcttgcaagttaatgttaagggcattcttgttgattgattatt |
26459142 |
T |
 |
| Q |
118 |
gatatgtcaggtctgtgcaagtttttattggctacttacacgtttat-ggttatgacttcatggggtacttgtttgtttcaagagaaagaactggtttta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26459143 |
gatatgtcaggtctgtgcaagtttttattggctacttacacgtttatgggttatgacttcatggggtacttgtttgtttcaagagaaagaactggtttta |
26459242 |
T |
 |
| Q |
217 |
ttttatgtctcttctttattttgttgttaacacaagcaagtaaaaatgcattatcttatttctgtg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26459243 |
ttttatgtctcttctttattttgttgttaacacaagcaagtaaaaatgcattatcttatttctgtg |
26459308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University