View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_low_61 (Length: 274)
Name: NF15735_low_61
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 6622817 - 6622559
Alignment:
| Q |
1 |
ctcaattgttgaacgagatgaggtaaatgttttaatttattatgactttgatctaaacaattttgtgctcatggaagtaaaagaaagcacttaaaatgtt |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
6622817 |
ctcaattgttcaacgagatgaggtaaatgttttaatttactatgactttgatcttaatgattttgtgctcatgaaagtaaaagaaagcactcaaaatgtt |
6622718 |
T |
 |
| Q |
101 |
gattcttctttcgaggggcatattgaagaaaagattgaacataaagtagaagagtttatatataccagaagcaaggtannnnnnnnnnnnatgtatttta |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |||| |||||| |||||||||| |
|
|
| T |
6622717 |
gattcttcttttgaggggcatattgaagaaaaaattaaacataaagtagaagagtttatatataccggaagaaaggta---tttttttttatgtatttta |
6622621 |
T |
 |
| Q |
201 |
tttgtgaattactt-ggcaatatgctcccttagagttgaacagtgtatttctataatatttc |
261 |
Q |
| |
|
||| |||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6622620 |
tttatgaattacttaggcaatatgctcccttagagttgaagagtgtatttctataatatttc |
6622559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University