View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_low_63 (Length: 272)
Name: NF15735_low_63
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 53192833 - 53193086
Alignment:
| Q |
1 |
gaccaacatgggagtactagtgcatatataaacatgctatcataatatatggctattgtataagattacttaaccttcatgcagtgaattttagaaccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53192833 |
gaccaacatgggagtactagtgcatatataaccatgctatcataatatatggctattgtataagattacttaaccttcatgcagtgaattttagaaccat |
53192932 |
T |
 |
| Q |
101 |
tggagacagtcttctttttccattcaatggaataagtagcacagggccaaagatttgatgagttggacttcaagcccacaaatccaggcccagcaactgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53192933 |
tggagacagtcttctttttccattcaatggaataagtagcactgggccaaagacttgatgagttggacttcaagcccacaaagccaggcccagcaactgg |
53193032 |
T |
 |
| Q |
201 |
agctgcaaatgttccagcagacattttaatcaaataaatgtctgatctttgaag |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53193033 |
agctgcaaatgttccagcagacattttaatcaaataaatgtctgatctttgaag |
53193086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University