View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_low_68 (Length: 253)
Name: NF15735_low_68
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_low_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 25 - 240
Target Start/End: Original strand, 7818457 - 7818675
Alignment:
| Q |
25 |
ggtttttcccaatacaattctctccaatccgttcacaagaa----tcactgagaaagaactttattatcatttctcttttatgtatgatgtttttgcttc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
7818457 |
ggtttttcccaatacaattctctccaatccgttcacaagaaagaatcagtgagaaagaactttattatcgtttctcttttatgtatgatgtttgtgcttc |
7818556 |
T |
 |
| Q |
121 |
ttctttgctcttactgtacgtgtgaattattcatgccttttaacacttgaaatgaaatctatctcagtccaagcaaccctccaagaaaagacccatgatt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7818557 |
ttctttgctcttactgtacgtgtgaattattcatg-cttttagtacttgaaatgaaatctatctcagtccaagcaaccctccaagaaaagacccatgatt |
7818655 |
T |
 |
| Q |
221 |
gtacattcaggtttattttc |
240 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
7818656 |
gtacattgaggtttattttc |
7818675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University