View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15735_low_78 (Length: 238)
Name: NF15735_low_78
Description: NF15735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15735_low_78 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 44 - 221
Target Start/End: Original strand, 3273042 - 3273219
Alignment:
| Q |
44 |
ataattatcacaaatggatctattttatgaaatgatatttgaggccatggatccatttagtattataattgatacattgaatttcattgtttgtttggtt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3273042 |
ataattatcacaaatggatctattttatgaaatgatatttgaggccatggatccatttagtattataattgatacattgaatttaattgtttgtttggtt |
3273141 |
T |
|
| Q |
144 |
atgtataatgcatatttgacccgttttgttatgtggttacttttgaggtgagatataatatatgatttgactccagtc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
3273142 |
ttgtataatgcatatttgacccgttttgttatgtggttactttcgaggtgagatataatatatgatttgactctagtc |
3273219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 3271024 - 3271068
Alignment:
| Q |
1 |
ttggatcttttatttcaaataatatggattttaggacgggtctat |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3271024 |
ttggatcttttatttcaaataatatggattttaggacggctctat |
3271068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University