View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15736_high_26 (Length: 233)
Name: NF15736_high_26
Description: NF15736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15736_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 230
Target Start/End: Complemental strand, 46110677 - 46110460
Alignment:
| Q |
13 |
attatctactttgaagtgtctcccctgccaaactcaagggaagtaataggcgaagtttcaaatacagcacattgggaatcaggatttggcttggacttat |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46110677 |
attatctactttgaagtctctcccctgccaaactcaagggaagtaataggcgaagtttcagatacagcacattgggaatcagaatttggcttggacttat |
46110578 |
T |
|
| Q |
113 |
ccttgaagtttacaccaggtggagaggttgatgttccagcaaaattttcatcatttttggagtcagatgctacaggttcctcaactgtccggatgggtgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46110577 |
ccttgaagtttacaccaggtggagaggttgatgttccagcaaaattttcatcatttttggagtcagatgctacaggttcctcaactgtccggatgggtgt |
46110478 |
T |
|
| Q |
213 |
ggctaacaggtccctatg |
230 |
Q |
| |
|
||||||| |||| ||||| |
|
|
| T |
46110477 |
ggctaacgggtctctatg |
46110460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 84 - 197
Target Start/End: Complemental strand, 46101147 - 46101034
Alignment:
| Q |
84 |
ttgggaatcaggatttggcttggacttatccttgaagtttacaccaggtggagaggttgatgttccagcaaaattttcatcatttttggagtcagatgct |
183 |
Q |
| |
|
||||| ||||| |||| |||||||||||||||| ||||||||| || |||||| ||||||||||| |||||||| |||||| |||||||||| ||||| |
|
|
| T |
46101147 |
ttgggcatcagactttgacttggacttatccttggagtttacactagatggagaagttgatgttcctgcaaaattctcatcacttttggagtctgatgcc |
46101048 |
T |
|
| Q |
184 |
acaggttcctcaac |
197 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
46101047 |
acaggttcatcaac |
46101034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University