View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15736_high_28 (Length: 221)
Name: NF15736_high_28
Description: NF15736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15736_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 13024044 - 13023993
Alignment:
| Q |
18 |
ggctgaacaatggttgttactctaatcaaatacaagaaacttatggtttaag |
69 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13024044 |
ggctgaacaaaggttgttactctaatcaaatacaagaaacttatggtttaag |
13023993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 206
Target Start/End: Complemental strand, 13023887 - 13023855
Alignment:
| Q |
174 |
gttatatcgaaatcgtgcttctccctcgttcat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13023887 |
gttatatcgaaatcgtgcttctccctcgttcat |
13023855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University