View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15736_low_16 (Length: 286)
Name: NF15736_low_16
Description: NF15736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15736_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 15 - 268
Target Start/End: Complemental strand, 28310046 - 28309793
Alignment:
| Q |
15 |
atgaagatacttgcaaagaatgaaaagttcgagaaaatcgtgagtcccacaatttggtttttgcaacatgtgtttacaagggaggaggagaatattgcta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28310046 |
atgaagatacttgcaaagaatgaaaagttcgagaaaatcgtgagtcccacaatttggtttttgcaacatgtgtttacaagggaggaggagaatattgcta |
28309947 |
T |
 |
| Q |
115 |
gtgaaaatgctagcagtgttgttgtggccacaagagacaggctgagcttcagcatccacccagccgtagccactatgataggagccgaggaagacggagg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
28309946 |
gtgaaaatgctagcagtgttgttgtggccataagagacaggctgagcttcaacatccacccggccgtagccactgtgataggagccgaggaagaaggagg |
28309847 |
T |
 |
| Q |
215 |
aagggagccaccgtgaggagcagacattgtttgagaagaggaagatgaagattc |
268 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28309846 |
aagggagccatggtgaggagtagacattgtttgagaagaggaagatgaagattc |
28309793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University