View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15736_low_18 (Length: 268)
Name: NF15736_low_18
Description: NF15736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15736_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 151 - 255
Target Start/End: Complemental strand, 8347032 - 8346928
Alignment:
| Q |
151 |
taactcttatgtttattaatagaaacagaaattttataatcttcatagtctttgtcatttaccaattgatcttcagttgggtaatatactacctctagct |
250 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8347032 |
taactcttatgtttatcaatagaaacagaaattttataatcttcatagtctttgtcatttaccaattgatcttcagttgggtaatatactacctctagct |
8346933 |
T |
 |
| Q |
251 |
cctct |
255 |
Q |
| |
|
||||| |
|
|
| T |
8346932 |
cctct |
8346928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 124
Target Start/End: Complemental strand, 8347165 - 8347059
Alignment:
| Q |
18 |
attttcgctttaaatagcatttttgttttaataatagactctatatgattaaatagtagtattatttactaaattaaccgcaatacatctcctcaattca |
117 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8347165 |
attttcgctttaaataacatttttgttttaataatagactctatatgattaaatagtggtattatttactaaattatccgcaatacatctcctcaattca |
8347066 |
T |
 |
| Q |
118 |
taattct |
124 |
Q |
| |
|
||||||| |
|
|
| T |
8347065 |
taattct |
8347059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University