View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15736_low_32 (Length: 214)
Name: NF15736_low_32
Description: NF15736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15736_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 27443789 - 27443992
Alignment:
| Q |
1 |
ctattttcaatgacacctatgtttagccaattaaaattttagtgaagtttttaaaacatacagcctgtttttctaattcnnnnnnnnnctttctcaatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
27443789 |
ctattttcaatgacacctatgtttagccaattaaaattttagtgaagtttttaaaacttacagcctgtttttctaattctttttttttctttctcaatgg |
27443888 |
T |
|
| Q |
101 |
tcaaactttagacttggtcatagaagtggctaataccacatcttaaaccaactctttatattatatcaaaatgtcaaacttcataaagtcgtacctatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
27443889 |
tcaaactttagacttggtcatagaagtggctaataccacatcttgaaccaactctttatattatatcaaaatgtcaaacttcataaagtcgtacctatac |
27443988 |
T |
|
| Q |
201 |
tact |
204 |
Q |
| |
|
|||| |
|
|
| T |
27443989 |
tact |
27443992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 94 - 142
Target Start/End: Original strand, 27441068 - 27441115
Alignment:
| Q |
94 |
tcaatggtcaaactttagacttggtcatagaagtggctaataccacatc |
142 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||| ||||||| |
|
|
| T |
27441068 |
tcaatggtcaaactttagacttagtcatagaagt-gctaatgccacatc |
27441115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 62
Target Start/End: Original strand, 27429518 - 27429564
Alignment:
| Q |
16 |
cctatgtttagccaattaaaattttagtgaagtttttaaaacataca |
62 |
Q |
| |
|
|||||||||||||||||||||||||| | | |||||||||| ||||| |
|
|
| T |
27429518 |
cctatgtttagccaattaaaattttaataaggtttttaaaatataca |
27429564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University