View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15737_low_3 (Length: 233)
Name: NF15737_low_3
Description: NF15737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15737_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 32766027 - 32765818
Alignment:
| Q |
16 |
cataggaggacacaa---gaaaccccccactctattgattatgaacaagaaggatcttatcaaacctggtgaagttgcaaagaaacttgaggttggaatc |
112 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32766027 |
cataggaggacacaaagagaaaccccccactctattgataatgaacaagaaggatcttatcaaacctggtgaagttgcaaagaaacttgaggttggaatt |
32765928 |
T |
|
| Q |
113 |
catttattagtatttaagtgtttataatagcatgtatagcttattcaactggtacagacatgatttttcgtgtgtttgcagtggtatacaaaatttactg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32765927 |
catttattagtatttaagtgtttataatagcatgtatagcttattcaactggtacagacatgatttttcgtgtgtttgcagtggtatacaaaatttactg |
32765828 |
T |
|
| Q |
213 |
atgttgatga |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
32765827 |
atgttgatga |
32765818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University