View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15738_high_6 (Length: 285)
Name: NF15738_high_6
Description: NF15738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15738_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 19 - 273
Target Start/End: Original strand, 9647413 - 9647663
Alignment:
| Q |
19 |
ccaagaaatagggtacaccaaaaatgtccattgttannnnnnnnnnn--aaactcggtatccggcccaaagactaattgatctgggatcaatcgctccgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9647413 |
ccaagaaatagggtacaccaaaaatgtccattgttattttattttttttaaactcggtatccggcccaaagactaattgatctgggatcaatcgctccgt |
9647512 |
T |
|
| Q |
117 |
ccactggcggacccaattgaagcccgaacaacttcttcaccacagccgtccagtcaatcactccactgccgccgccgccaccgcaatcctatctccctct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
9647513 |
ccactggcggacccaattgaagcccgaacaacttcttcaccacagccgtccagtcaatcact------ccgccgcccccaccgcaatcctatctccctct |
9647606 |
T |
|
| Q |
217 |
gtcactcgaacagtacaaacaaccgacaggtatgtcaaaagttcaattgttaacctt |
273 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9647607 |
gtcactcaagcagtacaaacaaccgacaggtatgtcaaaagttcaattgttaacctt |
9647663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University