View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15738_low_12 (Length: 257)
Name: NF15738_low_12
Description: NF15738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15738_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 962696 - 962439
Alignment:
| Q |
1 |
aatgaaattgtagtcatgatgaaacttgtggaaaaggagtgaaaatgatcaaaa-------------gaaagtgttgtttgtgatggcacaatggggtaa |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||| |
|
|
| T |
962696 |
aatgaaattgtagtcatgatgaaacttgtggaaaaggagtgaaaatgatcaaaatgaaaattgaaatgaaagtgttgtttgtgatggcataatggtgtaa |
962597 |
T |
|
| Q |
88 |
tggttttggtcctttttatagaggttggagaaagagaagcttctgtaaaactagtggcaattaatgtgctcaatgtctcataaagattcttgtttgaatt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
962596 |
tggttttggtcctttttatagaggttggagaaagagaagcttatgtaaaactagtggcaat----gtgctcaatatctcataaagattcttgtttgaatt |
962501 |
T |
|
| Q |
188 |
ttggaaatctttatattttgactattatttggataacaaccattttattttccgatgatgtc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
962500 |
ttggaaatctttatattttgactattatttggataacaaccattttattttcctattatgtc |
962439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University