View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15738_low_13 (Length: 232)
Name: NF15738_low_13
Description: NF15738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15738_low_13 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 85 - 232
Target Start/End: Original strand, 21913771 - 21913914
Alignment:
| Q |
85 |
cacgttaacaacttgacataagtcattacatcacatctgaaatttagcacagtcttcaaaacaaacactgtcactctctattgattgattattcttcata |
184 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21913771 |
cacgttaacaacttgacataagttattacatcacatctgaaatttagcacagtcttcaaaacaaacactgtcactctct----attgattattcttcata |
21913866 |
T |
|
| Q |
185 |
nnnnnnnnccaccatgaccgatttccaccaccaccaccaacaccgccc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21913867 |
ttttttttccaccatgaccgatttccaccaccaccaccaacaccgccc |
21913914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University