View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1573_high_21 (Length: 207)

Name: NF1573_high_21
Description: NF1573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1573_high_21
NF1573_high_21
[»] chr6 (1 HSPs)
chr6 (117-207)||(6530560-6530642)


Alignment Details
Target: chr6 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 117 - 207
Target Start/End: Complemental strand, 6530642 - 6530560
Alignment:
117 aaagaaaaattgcaactgctgaaggaattatataatctacttatctactaaatgagagtaaaataatagaattaaagggagcgctagaaac 207  Q
    |||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||    
6530642 aaagaaaaattgcaactgctgaaggaattatataatctact--------aaatgagagtaaaataatagaattaaagggagcgctagaaac 6530560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University