View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1573_low_12 (Length: 329)
Name: NF1573_low_12
Description: NF1573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1573_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 156 - 308
Target Start/End: Complemental strand, 6486830 - 6486678
Alignment:
| Q |
156 |
acaacaataataacattcctcgtccacagtttatgcaatccgaaccccgattttccacaacagaagcctatactgacgatgactatgccatgcgtagcag |
255 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486830 |
acaacaacaataacattcctcgtccacagtttatgcaatccgaaccccgattttccacaacagaagcctatactgacgatgactatgccatgcgtagcag |
6486731 |
T |
 |
| Q |
256 |
cagcgccgcctcccccatgagcccttactactacgaccctggcaggtctctcc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6486730 |
cagcgccgcctcccccatgagcccttactactacgaccctggaaggtctctcc |
6486678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 19 - 119
Target Start/End: Complemental strand, 6486970 - 6486867
Alignment:
| Q |
19 |
gttgcgctgtgtttttggtgtctgaatcggtgaaagagtaacaaacaaacaaaca----tcttgaatgatagtgagataagagagaaaagaggacatcat |
114 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486970 |
gttgcgctgt-tttttggtgtctgaatcggtgaaagagtaacaaacaaacaaacaaacatcttgaatgatagtgagataagagagaaaagaggacatcat |
6486872 |
T |
 |
| Q |
115 |
gtttg |
119 |
Q |
| |
|
||||| |
|
|
| T |
6486871 |
gtttg |
6486867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University