View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1573_low_16 (Length: 280)
Name: NF1573_low_16
Description: NF1573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1573_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 272
Target Start/End: Original strand, 44795183 - 44795437
Alignment:
| Q |
18 |
aaatcacagccctttcccacaaactccttatcacaattttggttcaaccattcgttttnnnnnnnnnnnnnnnnnnnatcggatctagggtttcattctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44795183 |
aaatcacagccctttcccacaaactccttatcacaattttggttcaaccattcgttttttctcttctcttctcttctatcggatctagggtttcattctc |
44795282 |
T |
 |
| Q |
118 |
atagatagagggttagggtttttgaaaacctctccaatgttgtttttacgacactaatgtatcgtattcgtctccttcattctttctccgttgcttttct |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44795283 |
atagagagagggttagggtttttgaaaacctctccaatgttgtttttacgacactaatgtatcgtattcgtctccttcattctttctccgttgcttttct |
44795382 |
T |
 |
| Q |
218 |
gtactggttttacgtcttttcataagcagctttctctaaatcgcttattcttctc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44795383 |
gtactggttttacgtcttttcataagcaactttctctaaatcgcttattcttctc |
44795437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University