View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1573_low_17 (Length: 245)
Name: NF1573_low_17
Description: NF1573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1573_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 15 - 202
Target Start/End: Original strand, 37045200 - 37045387
Alignment:
| Q |
15 |
tatgcaatatttcaaaggtgcaacatcatcttttgtatctatatgattattcagatagatatttacacggtattgtacatggaagctagctacattcaag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
37045200 |
tatgcaatatttcaaaggtgcaacatcatcttttgtatctatatgattattcagatagatatttacacggtattatacatgcaagctagctacattcaag |
37045299 |
T |
|
| Q |
115 |
tgaggtagtgcaattacaagaaagaagagaatagaccggcgaaatacaagggaaaacacgtagaaaggtatgaaaaatttggaaattt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37045300 |
tgaggtagtgcaattacaagaaagaagagaatagaccggcgaaatacaagggaaaacacgtagaaaggtatgaaaaatttggaaattt |
37045387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 13 - 180
Target Start/End: Original strand, 37032212 - 37032386
Alignment:
| Q |
13 |
aatatgcaatatttcaaaggtg-caacatcatcttttgtatctatatgattat------tcagatagatatttacacggtattgtacatggaagctagct |
105 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| | ||||||| ||||||| | ||| |||||| ||||||||| |
|
|
| T |
37032212 |
aatatgcaatatttcaaaggtgacaacatcatcttttgtatctatatgattatgattattaagatagacatttacagagcattatacatgcaagctagct |
37032311 |
T |
|
| Q |
106 |
acattcaagtgaggtagtgcaattacaagaaagaagagaatagaccggcgaaatacaaggg-aaaacacgtagaaa |
180 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| || || | ||| |||||||||| |||||||||||||| |
|
|
| T |
37032312 |
acattcaagtgaggtagtgcaa-tacaaaaaagaagaaaagagtgcagcggaatacaagggaaaaacacgtagaaa |
37032386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University