View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1573_low_8 (Length: 364)
Name: NF1573_low_8
Description: NF1573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1573_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 21 - 285
Target Start/End: Complemental strand, 25597711 - 25597435
Alignment:
| Q |
21 |
gagaatcttagattttatattggacttacatcatcctt-------cggcttataaggtgagcatttccctcctttgtaaacaattgctcacgtcatctct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25597711 |
gagaatcttagattttatattggacttacatcatccttgcaaaaccggtttataaggtgagcatttccctcacttgtaaacaattgctcacgtcatctct |
25597612 |
T |
|
| Q |
114 |
ttatctaacgtaggactcttaacacatcccctcacgcccatcactacttaatttggtgtgcggatataaatggtggatgacccaatgacaaa-----gat |
208 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25597611 |
ttatctaacgtaggactcttaacacaccccctcacgcccatcactacttagtttggtgtgcggatataaatggtggatgacccaatgacaaagatctgat |
25597512 |
T |
|
| Q |
209 |
agcagttgggtcaacagatcttgaaagaggctttgatatcatcttagatttgatagagactcatgtgtcttatttaa |
285 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25597511 |
agttgttgggtcaacagatcttgaaagaggctttgatatcatcttagatttgatagagactcaagtgtcttatttaa |
25597435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 296 - 360
Target Start/End: Complemental strand, 25594174 - 25594113
Alignment:
| Q |
296 |
ttattttaagggaaatattaatgagtgtcttattttttatttcttataaatatacatattcttcg |
360 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
25594174 |
ttattttaagggaaatattaacgagtgtcttatttt---tttcttataaatatacatatttttcg |
25594113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 256
Target Start/End: Original strand, 17423825 - 17423875
Alignment:
| Q |
206 |
gatagcagttgggtcaacagatcttgaaagaggctttgatatcatcttaga |
256 |
Q |
| |
|
|||||||| ||| |||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
17423825 |
gatagcaggtggctcaacagatctttgaagaggctttgataccatcttaga |
17423875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University