View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15741_high_18 (Length: 222)
Name: NF15741_high_18
Description: NF15741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15741_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 36 - 210
Target Start/End: Original strand, 4567001 - 4567176
Alignment:
| Q |
36 |
tctcaaatatacttgtcgaggataagaaactttaggccctataatcttaa-atataatatgataacataatacctaatcaacctaatctgtgaagacatg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4567001 |
tctcaattatacttgtcgaggataagaaactttaggccataggatcttaacatataatatgataacataatacctaatcaacctaatctgtgaagacatg |
4567100 |
T |
 |
| Q |
135 |
aaatattaatcaaaataagttgtaggtccattagttacgtcaggtgcatgtgaaactttccagatataaagatgat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4567101 |
aaatattaatcaaaataagttgtaggtccattagttacgtcaggtgcatgtgaaactttccagatataaagatgat |
4567176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University