View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15741_low_19 (Length: 261)
Name: NF15741_low_19
Description: NF15741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15741_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 227
Target Start/End: Complemental strand, 14130318 - 14130103
Alignment:
| Q |
11 |
caaaggatttatatgcagtctggtatagcaaccgcagttgcgactaaaacagccgtgattacttgtattccacggcaatattatgatttacagtgtaact |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14130318 |
caaaggatttatatgcagtctggtatagcaaccgcagttgcgactaaaacagccgtgattacttgtatttcacggcaatattatgatttacagtgtaact |
14130219 |
T |
|
| Q |
111 |
acaacagcgatcacaatttagaaccaaatttgtgcttttgttaagtttttgtatccaattctagtttctattttaagattataagatagtactagtttta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14130218 |
acaacagcgatcacaatttagaaccaaatttgtgcttttgttaagtttttgtatcc-attcaagtttctattttaagattataaggtagtactagttttg |
14130120 |
T |
|
| Q |
211 |
tacttatgagattaata |
227 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
14130119 |
tactcatgagattaata |
14130103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University