View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15742_low_9 (Length: 223)
Name: NF15742_low_9
Description: NF15742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15742_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 49 - 207
Target Start/End: Complemental strand, 25616751 - 25616596
Alignment:
| Q |
49 |
aattaggcctctcccaatctgaactgctttgattccgaactgtaccagcccgcgtctgttgcaatctgttgacctcataccactgctgtcaagaatgcat |
148 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
25616751 |
aattaggcctctcctaatctgaactgctttgattccgaactgtaccagcccgcgtctgttgcaatctgttgacctcataccactgctgccaagaattcat |
25616652 |
T |
|
| Q |
149 |
tgttttccttccaatactagctggtagagttactcttaaactcttccacaccagttcat |
207 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
25616651 |
tgttttcctttcaacactagctg---aagttactctcaaactcttccactccagttcat |
25616596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 98 - 204
Target Start/End: Original strand, 25612416 - 25612522
Alignment:
| Q |
98 |
ccgcgtctgttgcaatctgttgacctcataccactgctgtcaagaatgcattgttttccttccaatactagctggtagagttactcttaaactcttccac |
197 |
Q |
| |
|
||||||||||||||| |||||||| ||||| |||| ||| |||||| |||| ||||||||||||| |||||||| | || ||||||| |||||||||||| |
|
|
| T |
25612416 |
ccgcgtctgttgcaacctgttgacttcatatcactactgccaagaacgcatagttttccttccaacactagctgatggaattactctcaaactcttccac |
25612515 |
T |
|
| Q |
198 |
accagtt |
204 |
Q |
| |
|
||||||| |
|
|
| T |
25612516 |
accagtt |
25612522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University