View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15743_high_18 (Length: 321)
Name: NF15743_high_18
Description: NF15743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15743_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 7e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 38 - 143
Target Start/End: Original strand, 42309447 - 42309552
Alignment:
| Q |
38 |
tcatgacccaactaggagactttttattttgtgaaaaagccaaggttttcaatgtagtggtttcagggtactaatatttccatttaccttcttttatcta |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42309447 |
tcatgacccaactaggagactttttattttgtgaaaaaaccaaagtgttcaatgtagtggtttcagggtactaatatttccatttaccttcttttatcta |
42309546 |
T |
|
| Q |
138 |
ttttag |
143 |
Q |
| |
|
|||||| |
|
|
| T |
42309547 |
ttttag |
42309552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 206 - 292
Target Start/End: Original strand, 42309603 - 42309689
Alignment:
| Q |
206 |
ctatcttttagaaaggaatataattttatatgttcatcttgcattgcctctgtttctttgtgcagtttatgatttgcttggactgtt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42309603 |
ctatcttttagaaaggaatataattttatatgttcatcttgcattgcctctgtttctttgtgcagtttatgatttgcttggactgtt |
42309689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University