View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15744_high_16 (Length: 307)
Name: NF15744_high_16
Description: NF15744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15744_high_16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 20 - 307
Target Start/End: Original strand, 2222844 - 2223131
Alignment:
| Q |
20 |
taagaggaagttgtcaaatattatggatgatcctaataatattgttgccgacaatattaataaatctaaagaaattgagcggcgttacgatgattataga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222844 |
taagaggaagttgtcaaatattatggatgatcctaataatattgttgccgacaatattaataaatctaaagaaattgagcggcgttacgatgattataga |
2222943 |
T |
 |
| Q |
120 |
aggaagagaaagcgtccatgcaaagtggcggtggttcctacgatggaatcaaccaccggagaaaccgccaccacgtcacatggttttatatcggtgattg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2222944 |
aggaagagaaagcgtccatgcaaagtggcagtggttcctacgatggaatcaaccaccggagaaaccgccaccgcgtcacatggttttatatcggtgattg |
2223043 |
T |
 |
| Q |
220 |
ggcggaggagggtgatggaagatgctattaaggtgattccacgttttgtggcgacggagcagcaactgtgcggttatgatttctttgc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
2223044 |
ggcggaggagggtgatggaagatgctattaaggtgattccacgttttgtggcggcggagcagcaaccgtgcggttatgatttctttgc |
2223131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University