View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15744_high_21 (Length: 254)
Name: NF15744_high_21
Description: NF15744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15744_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 15 - 139
Target Start/End: Original strand, 3644391 - 3644515
Alignment:
| Q |
15 |
cataggatatggatgaaagagaaattttgagggaaactttgctatctcaagaacaagattttccttcttctttgatcacttatttatactttggtcactt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3644391 |
cataggatatggatgaaagagaaattttgagggaaactttgctatctcaagaacaagattttccttcttctttgatcacttatttatactttggtcactt |
3644490 |
T |
 |
| Q |
115 |
tttagctagatggggttccaggttc |
139 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3644491 |
tttagctagatggggttccaggttc |
3644515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 206 - 254
Target Start/End: Original strand, 3644582 - 3644630
Alignment:
| Q |
206 |
gcactattgaattgaacttgatccttttgttgatatatatattttatat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3644582 |
gcactattgaattgaacttgatccttttgttgatatatatattttatat |
3644630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 139
Target Start/End: Original strand, 3634593 - 3634643
Alignment:
| Q |
89 |
atcacttatttatactttggtcactttttagctagatggggttccaggttc |
139 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
3634593 |
atcacttatttatacattggccactttttatctagatggggttccaggttc |
3634643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University