View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15744_high_24 (Length: 238)
Name: NF15744_high_24
Description: NF15744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15744_high_24 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 111 - 238
Target Start/End: Complemental strand, 46740047 - 46739921
Alignment:
| Q |
111 |
tgaggaaccaacaaacaagatttttccttnnnnnnncaaagattttaaaatgaggatcaaaatttcattttttgaaaataatgatatcaaacatggattt |
210 |
Q |
| |
|
||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46740047 |
tgaggaaccaaaaaagaagatttttccttaaaaaaacaaagattttaaaatgaggatcaaaatttcattttttgaaaataatgatatcaaaca-ggattt |
46739949 |
T |
 |
| Q |
211 |
aannnnnnnctttcgaataaaatatatt |
238 |
Q |
| |
|
|| | ||||||||||||||||| |
|
|
| T |
46739948 |
aatttttttcattcgaataaaatatatt |
46739921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 17 - 58
Target Start/End: Complemental strand, 46740141 - 46740100
Alignment:
| Q |
17 |
acaatgactccaaagtagttgtttccaatgaataatattagc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46740141 |
acaatgactccaaagtagttgtttccaatgaataatattagc |
46740100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University