View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15744_high_26 (Length: 236)
Name: NF15744_high_26
Description: NF15744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15744_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 2 - 229
Target Start/End: Complemental strand, 51010463 - 51010236
Alignment:
| Q |
2 |
tatcatgttcctcttctgtgttggatttgagagtgttgttgttttcatgatcatgaaggaatggaccttggtattcttcagagaaggttccatcgttctt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51010463 |
tatcatgttcctcttctgtgttggatttgagagtgttgttgttttcgtgatcatgaaggaatggacctaggtattcttcagagaaggttccatcgttctt |
51010364 |
T |
|
| Q |
102 |
gattcggttttgttgttgattgtaactgtaattgaactgttgcatgaagttcaatacagagatgtcatgtggaagattcaatgtctctgatggatggaaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51010363 |
gattcggttttgttgttgattgtaactgtaattgaactgttgcatgaagttcaatacagagatgtcatgtggaagattcaatgtctctgatggatggaaa |
51010264 |
T |
|
| Q |
202 |
atattgtttgtgttatcattttcatctc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
51010263 |
atattgtttgtgttatcattttcatctc |
51010236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University