View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15744_high_29 (Length: 206)

Name: NF15744_high_29
Description: NF15744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15744_high_29
NF15744_high_29
[»] chr8 (2 HSPs)
chr8 (1-73)||(34034908-34034980)
chr8 (147-181)||(34035054-34035088)


Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 34034908 - 34034980
Alignment:
1 taagtttttagttttatattgtttgatatggcgcgtagactagttatatagaggtagtagactagagttagtt 73  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34034908 taagtttttagttttatattgtttgatatggcgcgtagactagttatatagaggtagtagactagagttagtt 34034980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 147 - 181
Target Start/End: Original strand, 34035054 - 34035088
Alignment:
147 tattattaattgacttttagtcttttcttgctcac 181  Q
    |||||||||||||||||||||||||||||||||||    
34035054 tattattaattgacttttagtcttttcttgctcac 34035088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University