View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15744_high_9 (Length: 336)
Name: NF15744_high_9
Description: NF15744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15744_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 185 - 316
Target Start/End: Complemental strand, 27819816 - 27819684
Alignment:
| Q |
185 |
agtaaccatgcatttcaccatcaatagatatatagatagagttgctaatttgaaaatggcttcaatccaactgcagaacactagattgaacctaaatcct |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27819816 |
agtaaccatgcatttcaccatcaatagatatatagatagagttgctaatttgaaaatggcttcaatccaactgcagaacactagattgaacctaaatcct |
27819717 |
T |
 |
| Q |
285 |
ttcaatactttgag-aaaaaagaccactccaag |
316 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
27819716 |
ttcaatactttgagcaaaaaagaccactccaag |
27819684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University