View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15744_low_20 (Length: 295)
Name: NF15744_low_20
Description: NF15744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15744_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 23 - 255
Target Start/End: Original strand, 48007609 - 48007840
Alignment:
| Q |
23 |
aaatttggatatggtacagtttctttcttgcaaggttttgaatgaaatttgctagattgccgaatagaaaatagggatatgatagctagatggtcgacca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |||||||| || |
|
|
| T |
48007609 |
aaatttggatatggtacagtttctttcttgcaaggttttgaatgaaatttgctagattaccgaatagaaaatagggatatgatatatatatggtcgaaca |
48007708 |
T |
 |
| Q |
123 |
aaggagattaggtttagtgaaaagtgtcagacgaaatgttcatatttagtgttaaatagcttctcgaatatgattcttnnnnnnngatgatgtctatggt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
48007709 |
aaggagattaggtttagtgaaaagtgtcagacgaaatgttcatatttagtgttaaatagcttctcgaatatgattctt-aaaaaagatgatgtatatggt |
48007807 |
T |
 |
| Q |
223 |
caaactattactttcatgcattcttggttctcc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48007808 |
caaactattactttcatgcattcttggttctcc |
48007840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 75
Target Start/End: Original strand, 1604283 - 1604338
Alignment:
| Q |
20 |
gggaaatttggatatggtacagtttctttcttgcaaggttttgaatgaaatttgct |
75 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
1604283 |
gggaaattcggatatggtacagtttttttcttgcaaggttttgtatgaaatttgct |
1604338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University