View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15744_low_27 (Length: 245)
Name: NF15744_low_27
Description: NF15744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15744_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 20 - 229
Target Start/End: Complemental strand, 38454917 - 38454708
Alignment:
| Q |
20 |
acaacaacgttcaggaaattatggagacgctgtagctggctggatcagcaaaatcttcaaggcacacaannnnnnnnnnnnnnnnnnagttacactgtca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38454917 |
acaacaacgttcaggaaattatggagacgctgtagctggctggatcagcaaaatcttcaaggcacacaattttttattcttttttatagttacactgtca |
38454818 |
T |
|
| Q |
120 |
tgactcgtcactcgtgagtattgttctttaaacaaaacatcacatgcagattagttattcaatactaacatgcaatggaaatatttttccacgtttgaat |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38454817 |
tgactcgtgactcgtgagtattgttctttaaacaaaacatcacatgtaaattagttattcaatactaacatgcaatggaaatatttttccacctttgaat |
38454718 |
T |
|
| Q |
220 |
cactcccttt |
229 |
Q |
| |
|
||||||||| |
|
|
| T |
38454717 |
tactcccttt |
38454708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University