View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15744_low_29 (Length: 237)
Name: NF15744_low_29
Description: NF15744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15744_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 16 - 217
Target Start/End: Original strand, 49651807 - 49652012
Alignment:
| Q |
16 |
taggcatatgttttttccctcagctttggcgcttttactttgtcttatgctatttcttggttcgattttgagctcctcctagagaaaaggataaaagggt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49651807 |
taggcatatgttttttccctcagctttggcgcttttactttgtcttatgctattttttggttcgattttgagctcctcctagagaaaaggataaaagggt |
49651906 |
T |
 |
| Q |
116 |
gtgttcataatttcttatcaatttaaagcatg----gctagtactaatttgaaatgttatgctcaaaacaaaccagcaacaaccgtccaatcctccatca |
211 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49651907 |
gtgttcataatttcttatcaaattaaagcatggctagctagtactaatttgaaatgttatgctcaaaataaaccagcaacaaccgtccaatcctccatca |
49652006 |
T |
 |
| Q |
212 |
ccacaa |
217 |
Q |
| |
|
|||||| |
|
|
| T |
49652007 |
ccacaa |
49652012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University