View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15744_low_32 (Length: 220)
Name: NF15744_low_32
Description: NF15744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15744_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 24 - 202
Target Start/End: Original strand, 7068641 - 7068819
Alignment:
| Q |
24 |
gtgtgtctcgtagcatcgttctctctttctcgccaccatgacggacggtcatctctttaacaacattaccctcggcggccgtggcggcaccgtaagctct |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7068641 |
gtgtgtctcgtagcatcgttctctctttctcgccaccatgacggacggtcatctctttaacaacattaccctcggcggccgtggcggcaccgtaagctct |
7068740 |
T |
|
| Q |
124 |
ctctcttccattttcgatcctctttcctcaagctttcatcatttcctcttttcttaaccctaacttttaataccctttt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7068741 |
ctctcttccattttcgatcctctttcctcaaactttcatcatttcctcttttcttaaccctaacttttaatcccctttt |
7068819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 61 - 129
Target Start/End: Complemental strand, 35502500 - 35502432
Alignment:
| Q |
61 |
atgacggacggtcatctctttaacaacattaccctcggcggccgtggcggcaccgtaagctctctctct |
129 |
Q |
| |
|
||||| |||||||||||||| ||||| || ||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
35502500 |
atgactgacggtcatctcttcaacaatatcaccctcggcggccgtggcggcactgtcagctctctctct |
35502432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University