View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15744_low_33 (Length: 206)
Name: NF15744_low_33
Description: NF15744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15744_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 34034908 - 34034980
Alignment:
| Q |
1 |
taagtttttagttttatattgtttgatatggcgcgtagactagttatatagaggtagtagactagagttagtt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34034908 |
taagtttttagttttatattgtttgatatggcgcgtagactagttatatagaggtagtagactagagttagtt |
34034980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 147 - 181
Target Start/End: Original strand, 34035054 - 34035088
Alignment:
| Q |
147 |
tattattaattgacttttagtcttttcttgctcac |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34035054 |
tattattaattgacttttagtcttttcttgctcac |
34035088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University