View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15745_high_105 (Length: 232)

Name: NF15745_high_105
Description: NF15745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15745_high_105
NF15745_high_105
[»] chr3 (1 HSPs)
chr3 (15-218)||(45782548-45782751)


Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 45782751 - 45782548
Alignment:
15 aaagggtaattactcataggaacaagagctaatttataaagaacgcgattagcaacagctaaagaaactgtagtagcggaggttaataaaacagnnnnnn 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          
45782751 aaagggtaattactcataggaacaagagctaatttataaagaacgcgattagcaacagctaaagaaactgtagtagcggaggttaataaaacagtttttt 45782652  T
115 nagttgcagtggaccaatcggaagaagaggaagaagatgaagattggaatttgaaaacggttcgatgtttgagattggaagaaggtaaatggaatggtga 214  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45782651 tagttgcagtggaccaatcggaagaagaggaagaagatgaagattggaatttgaaaacggttcgatgtttgagattggaagaaggtaaatggaatggtga 45782552  T
215 tttt 218  Q
    ||||    
45782551 tttt 45782548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University